This workshop provides an overview of bioinformatics covering applications, sequencing technologies, and basic workflows. Participants will also explore various file formats in bioinformatics and gain hands-on experience using NCBI’s BLAST web tool to perform sequence alignments and interpret results.
Pre-Workshop Instructions
To help minimize technical issues and delays at the start of the workshop, please try the following prior to the workshop.
- Logging on to Ceres Open OnDemand (OOD): Please confirm you can successfully log in to Ceres OOD with your SCINet account (see instructions here). If you are successful, you will be able to see the Ceres OOD home page.
- Ceres Shell Access: When on Ceres OOD, click on the top navigation bar: “Clusters” > “Ceres Shell Access”. A new tab will appear that looks like a shell terminal (e.g., like PowerShell). Please confirm you do not receive any error messages or requests to re-authenticate and that the final line looks like “[firstname.lastname@ceres ~]$”
- RStudio Server: Back on the main Ceres OOD tab, click on the top or side navigation bar: “Interactive Apps” > “RStudio Server”.
- Fill the input fields with the following (input fields not listed below can be left at their default values):
- Account: scinet_workshop2
- Queue: ceres
- QOS: 400thread
- R Version: 4.4.1
- Number of hours: 1
- Number of cores: 1
- Memory required: 8GB
- Optional Slurm Arguments: (leave empty)
- Click the “Launch” button.
- Wait a moment for the job card to update from “Queued” to “Running”.
- Please confirm that clicking on the “Connect to RStudio Server” button opens a new tab with the RStudio Server interface.
- Fill the input fields with the following (input fields not listed below can be left at their default values):
Tutorial Setup Instructions
Steps to prepare for the tutorial session:
- Login to Ceres Open OnDemand. For more information on login procedures for web-based SCINet access, see the SCINet access user guide.
- Open a command-line session by clicking on “Clusters” -> “Ceres Shell Access” on the top menu. This will open a new tab with a command-line session on Ceres’ login node.
-
Request resources on a compute node by running the following command.
srun --reservation=wk1_workshop -A scinet_workshop2 -t 05:00:00 -n 1 --mem 8G --pty bash- For those accessing post-workshop:
Remove--reservation=wk1_workshopand change-A scinet_workshop2to your own project account.
For additional information, see our SLURM guide.
- For those accessing post-workshop:
-
Create a workshop working directory by running the following commands. Note: you do not have to edit the commands with your username as it will be determined by the $USER variable.
mkdir -p /90daydata/shared/$USER/intro_bioinformatics cd /90daydata/shared/$USER/intro_bioinformatics cp -r /project/scinet_workshop2/Bioinformatics_series/wk1_workshop/day1/ . -
Load the environment:
module load miniconda source activate /project/scinet_workshop2/Bioinformatics_series/conda/
Tutorial Introduction
In this tutorial we will use the command line and other bioinformatics tools to explore the different types of data you will encounter in bioinformatics. The exercises and examples provided will guide you through understanding file structures, examining sequences and their associated quality scores and parsing/filtering variant data. We will also explore public databases and use BLAST for performing sequence alignment.
Throughout the tutorial we will use the following command-line tools:
- Basic text processing:
grep,cut,bioawk,wc - Quality control:
fastqc - Filtering variants:
bcftools - Downloading public data:
wget - Raw sequences from NCBI SRA:
SRA Toolkit
Exploring Bioinformatics File Formats
| Format | Description | Use case | File extensions |
|---|---|---|---|
|
FASTA |
text file with nucleotide or protein sequences |
stores raw sequence data |
|
|
FASTQ |
text file with sequences and quality scores |
next-generation sequencing reads |
|
|
SAM/BAM |
sequence alignment map (SAM) and binary alignment map (BAM) |
stores aligned reads |
|
|
VCF |
variant call format |
stores genomic variants (e.g. SNPs) |
|
|
GFF/GTF |
9 column text format with genomic features |
stores information about gene annotation |
|
Part 1: Exploring FASTA Files
FASTA files contain a single-line description and ID followed by one or more lines of sequence data.
Line 1: starts with “>” followed by ID
Line 2: Sequence data
Let’s take a look at an actual file:
-
Are you in the right working directory?
cd /90daydata/shared/$USER/intro_bioinformatics /day1 -
We can look at the beginning of the file by using
head, which displays the first few lines of files.head files/GCF_000001735.4_TAIR10.1_genomic.fna -
We can also view the first 4 lines using
-n:head -n 4 files/GCF_000001735.4_TAIR10.1_genomic.fna -
We can also look at the last few lines of the file by using
tail:tail files/GCF_000001735.4_TAIR10.1_genomic.fna -
For a scrollable preview of a file we can use less:
less files/ GCF_000001735.4_TAIR10.1_genomic.fna
Counting the number of sequences with grep:
grep is a search tool that is commonly used to find lines that match a pattern.
grep -c "^>" files/GCF_000001735.4_TAIR10.1_genomic.fna
grep: used for matching lines-c: count; prints number of matching lines"^>": regular expression pattern that matches any line that starts with>
Determine sequence lengths with bioawk:
Quick Guide on bioawk
bioawk is an extension of awk, which is a tool used for parsing and processing text files. bioawk has specialized features to handle biological file formats.
awk |
bioawk |
|---|---|
|
general text processing |
specialized for biological files |
|
does not understand the format of biological files |
aware of biological file formats |
|
manually split fields that are identified only by number (e.g., |
Automatically generates named fields from file contents (e.g., |
|
requires extra code/logic to parse biological data |
has built-in functions for parsing sequences, reads and variants |
| Command | Description | Fields |
|---|---|---|
|
|
parses FASTA and FASTQ files |
|
|
|
parses genetic variants (VCF) |
|
Basic format of a bioawk command:
bioawk -c <file format> 'action' input_file
Get sequence names and lengths
bioawk -c fastx '{print $name, length($seq)}' files/GCF_000001735.4_TAIR10.1_genomic.fna | head
Note: The pipe | in the line of code above is taking the output of the command on the left and using it as the input for the command on the right.
Note: The {} is telling bioawk to perform the action provided on each line/record
Part 2: Exploring FastQ files
FastQ files are similar to fasta files, but also contain the quality score of the sequence data.
Line 1: starts with “@” followed by ID
Line 2: Sequence data
Line 3: Starts with “+”
Line 4: Quality score for each base in the sequence
Quality scores indicate the confidence of the base call by the sequencer.
- Quality scores are encoded as American Standard Code for Information Interchange (ASCII) characters.
- Different types of encodings are available and vary across sequencing technologies
Phred quality score (Q) calculation:
[
Q= -10 \times \log_{10}(P)
]
Where:
- (Q) = Phred quality score
- (P) = probability that base call is incorrect
| ASCII Char | Phred Score | Error Probability |
|---|---|---|
|
! |
0 |
1.00 |
|
I |
40 |
0.0001 |
|
@ |
31 |
0.00079 |
| Phred Score | Error Probability | Interpretation |
|---|---|---|
|
10 |
1 in 10 |
90% accurate |
|
20 |
1 in 100 |
99% accurate |
|
30 |
1 in 1000 |
99.9% accurate |
|
40 |
1 in 10000 |
99.99% accurate |
Let’s take a look at an actual file:
head files/SRR4420293_1.fastq
head -n 4 files/SRR4420293_1.fastq
We can also use bioawk:
As a reminder of the format of bioawk commands:
bioawk -c <file format> 'action' input_file
bioawk -c fastx '{print $name, length($seq), $qual}' files/SRR4420293_1.fastq | head -n 5
Note: The pipe | in the line of code above is taking the output of the command on the left and using it as the input for the command on the right.
Other ways to count the number of reads:
-
Count lines using wc:
wc -l files/SRR4420293_1.fastqBut this gives line counts. Is that what we want? What should we do here to get the number of reads?
-
First let’s get the number of lines without the file name:
wc -l < files/SRR4420293_1.fastq“<” here is feeding the contents of the file into wc without passing the filename as an argument. This is called input redirection.
-
In order for us to do integer math directly in bash we need:
$((….))and for us to see the result of the calculation in the shell we will use echo.echo $(( $(wc -l < files/SRR4420293_1.fastq)/4)) -
We also need to put the wc function in
$(), which will cause bash to execute the command inside the parentheses and then use the output when evaluating the rest of the command:echo $(( $(wc -l < files/SRR4420293_1.fastq)/4))Let’s again break down the pieces of this solution:
$(wc -l < files/SRR4420293_1.fastq): to get line count$((....)): Do integer math directly in Bash:echo: prints the result
-
-
Using bioawk:
bioawk -c fastx 'END {print NR}' files/SRR4420293_1.fastq- `NR` - a built in variable in `bioawk` that stands for the number of records/reads - `END`: end of the fileWhat’s the average read length?
bioawk -c fastx '{sum += length($seq)} END {print sum/NR} files/SRR4420293_1.fastq- `sum += length($seq)` keeps adding each read's length to a running total
Let’s look at the file quality using FastQC
FastQC is a tool used to check the quality of sequencing reads from FASTQ files. The report tells us about base quality, sequence length distributions, adapter content, GC content and overrepresented sequences.
module load fastqc
mkdir fastqc_output
fastqc -o fastqc_output files/SRR4420293_1.fastq
-o: output directory
Part 3: Exploring Variant Call Format (VCF) Files
These files store sequence variants, SNPs and indels.
- Metadata lines: each line starts with ## followed by key=value pairs
- single header line: starts with single # and describes columns in the data lines
- data lines: sequence variation data
Layout and structure of VCF files:
-
View the header only
grep '^#' files/chinook.vcf | less -
View the first few variant lines:
grep -v '^#' files/chinook.vcg | lessNote:
-vtells grep to invert the match and only show lines that do *not match the pattern provided*
Inspecting columns in VCF files
| Column No. | Name | Description |
|---|---|---|
|
1 |
CHROM |
Chromosome name or contig |
|
2 |
POS |
Position of variant |
|
3 |
ID |
Identifier |
|
4 |
REF |
Reference alle |
|
5 |
ALT |
Alternate allele(s) |
|
6 |
QUAL |
Quality score for the variant |
|
7 |
FILTER |
Pass/fail status |
|
8 |
INFO |
Additional annotation |
-
The
cutcommand can be used to extract specific columns/fields from a file.cut -f1 files/chinook.vcf | head -n 5 -
Let’s remove the header:
cut -f1 files/chinook.vcf | grep -v '^#' | head -n 5 - What chromosomes/contigs are in this file?
-
Let us look at the first column, remove the header and sort the chromosomes/contigs:
cut -f1 files/chinook.vcf | grep -v '^#' | sort | less -
Now, let’s get rid of the repeats using uniq:
cut -f1 files/chinook.vcf | grep -v '^#' | sort | uniq | less
-
-
What’s in the INFO column?
cut -f8 files/chinook.vcf | grep -v '^#' | head -n 5 - Let’s look at the kinds of mutations
-
To do this we will extract column 5 (ALT) and remove the header:
cut -f5 files/chinook.vcf | grep -v '^#' | head -
Next, we will sort the variants :
cut -f5 files/chinook.vcf | grep -v '^#' | sort | head -
Let’s get rid of the repeats and count how many times each uniq variant appears:
cut -f5 files/chinook.vcf | grep -v '^#' | sort | uniq -c | head -
Lastly, let’s sort the results with the most frequent variant at the top
cut -f5 files/chinook.vcf | grep -v '^#' | sort | uniq -c | sort -nr| headNote: using -nr sorts the results numerically and in reverse order
-
If we wanted to do more complex, format-aware analyses we could do that with bcftools and bioawk.
Look at a VCF file using bcftools and bioawk:
Using bioawk:
bioawk -c vcf '{print $chrom, $pos, $ref, $alt, $qual}' files/chinook.vcf | head -n 5
While bioawk is a versatile tool for processing files in various biological sequence data formats, bcftools was specifically built for working with VCF and BCF files. To further understand the VCF structure, metadata, and complex filtering, we will focus on using bcftools for the remainder of the tutorial.
Using bcftools:
bcftools is a command-line tool used for viewing, filtering and manipulating VCF files. We will use bcftools to help us summarize variant info and for extracting and selecting variants.
| Option | Explanation |
|---|---|
|
-r |
the output is restricted to a specific region |
|
i |
include records that satisfy the given condition |
|
-v |
filter to show the variant type |
|
-H |
skips the VCF header lines and prints the variant lines only |
| command | function |
|---|---|
|
view |
Filter and subset VCFs |
|
query |
Extract custom fields from VCF |
|
stats |
Generate VCF summary statistics |
module load bcftools
bcftools view files/chinook.vcf | head -n 20
We can use the bcftools query command to inspect columns similar to how we used cut, but instead of calling column numbers we can use the column name:
bcftools query -f '%INFO\n' files/chinook.vcf | head
bcftools query -f '%CHROM\n' files/chinook.vcf | head
bcftools query -f '%QUAL\n' files/chinook.vcf | head
-
Count the total number of variants:
bcftools view -H files/chinook.vcf| wc -lNote: -H skips the header lines
- Filtering variants
-
By quality:
bcftools view -i 'QUAL>1000' files/chinook.vcf > high_qual_bcf.vcfhead high_qual_bcf.vcfIf we want to remove the headers, what can we do here?
-
By variant type:
bcftools view -v snps -H files/chinook.vcf | lessbcftools view -v snps files/chinook.vcf -0z -o snps_only_bcf.vcf -
By the number of reads supporting the variant (Depth):
bcftools view -i 'INFO/DP>10' -H files/chinook.vcf | less -
Can we combine filters? For example, what if we wanted to filter for QS >=1000 and depth >=30:
bcftools view -i 'QUAL > = 1000 && INFO/DP>30' -H files/chinook.vcf | less
-
-
VCF file summary with
bcftools
bcftoolscan generate summary statistics file on your VCF files:bcftools stats files/chinook.vcf > stats_vcf.txtless stats_vcf.txt-
To plot:
plot-vcfstats -p stats_output stats_vcf.txt
-
Exploring public repositories/databases
We will now explore a few public repositories. The most commonly used repositories/public databases are hosted by NCBI National Center for Biotechnology Information.
Let’s explore the website:
- Multiple Databases
- Landing Page:
- Submitting sequences
- Downloading sequences
- Tutorials
- Developing APIs/Code libraries
- Various tools
- Explore research
- Popular Resources
Use cases for a scientist
- Literature search
- Exploring a gene sequence
- Exploring genomes
- Downloading data
Another popular public database is the European Nucleotide Archive. This archive primarily started as a repository for storing raw sequence data, metadata etc. In this respect it is similar to the databases hosted by NCBI but they have different toolsets.
| Feature | NCBI (USA) | ENA (Europe) |
|---|---|---|
|
Main Role |
Central US resource for genomic data storage and retrieval |
Central European resource for nucleotide data archiving |
|
Organization |
National Center for Biotechnology Information (NIH) |
European Nucleotide Archive (EMBL-EBI) |
|
Key Databases |
SRA, GenBank, RefSeq, GEO, dbSNP |
ENA (includes raw reads, assemblies, annotations) |
|
Data Submission |
Accepts direct submissions via SRA Submission Portal |
Submissions via Webin Portal |
|
Data Access |
Via web, |
Via web, RESTful APIs, FTP, and direct links |
|
Data Sharing |
Collaborates with INSDC (ENA & DDBJ) for daily sync |
Also part of INSDC — fully synchronized with NCBI and DDBJ |
|
Data Format |
|
Direct FASTQ/FASTA/TSV downloads (simpler access) |
|
Typical Use Case |
US-based research and NIH-funded data |
EU-based research or quick bulk access |
International Collaboration
Both NCBI and ENA are members of the INSDC (International Nucleotide Sequence Database Collaboration), along with DDBJ (Japan).
They synchronize data daily, so any data submitted to one appears in the others.
| Feature | NCBI (National Center for Biotechnology Information) | ENA (European Nucleotide Archive) |
|---|---|---|
|
Primary Portal |
https://www.ncbi.nlm.nih.gov/ |
https://www.ebi.ac.uk/ena |
|
Search Interface |
Entrez (integrated search for all databases) |
ENA Browser (data-centric search) |
|
BLAST Access |
NCBI BLAST web interface |
EMBL-EBI BLAST service |
|
FTP Access |
ftp.ncbi.nlm.nih.gov |
ftp.ebi.ac.uk/pub/databases/ena |
|
APIs & Programmatic Access |
E-utilities (Entrez API), Datasets, SRA-tools |
ENA Portal API, ENA REST API |
|
Submission Portals |
BioProject, SRA, GenBank, GEO, dbGaP submission tools |
Webin (single portal for all data types) |
|
Visualization Tools |
Genome Data Viewer, GEO Profiles |
Interactive web viewers for entries |
|
Data Download Options |
Datasets command-line tool, direct FTP/HTTP links |
Direct FTP, programmatic downloads |
|
Help & Documentation |
Extensive help docs, NCBI Handbook, video tutorials |
ENA Docs, FAQs, webinars |
Both portals are interoperable through the INSDC framework. Tools and formats often overlap in functionality.
Download data with SRA toolkit
Demonstrate some SRA sequence downloads from NCBI and compare with ENA
There are two ways to get the SRR list:
- From the website:
- SRP433780
- Go to the link above and send the results to run selector
- Command line step-by-step:
# Load the modules
module load edirect/23.6.20250307
module load sratoolkit
# get the complete SRA run information file and cull the SRR accesion list and save in a file
esearch -db sra -query SRP433780 | efetch -format runinfo > SRP433780_runinfo.csv
cut -d ',' -f1 SRP433780_runinfo.csv | grep SRR > SRR_accessions.txt
# check SRR_accessions.txt and select one to download in two steps:
prefetch SRR24255343
fasterq-dump SRR24378108 --split-files --threads 4
BLAST
The NCBI blast website is the most popular tool with the NCBI.
| Tool | Query Type | Database Type | Description |
|---|---|---|---|
|
blastn |
Nucleotide |
Nucleotide |
Compares nucleotide query to nucleotide DB |
|
blastp |
Protein |
Protein |
Compares protein query to protein DB |
|
blastx |
Nucleotide (translated) |
Protein |
Translates nucleotide query, searches protein DB |
|
tblastn |
Protein |
Nucleotide (translated) |
Translates nucleotide DB, searches with protein query |
|
tblastx |
Nucleotide (translated) |
Nucleotide (translated) |
Translates both query and DB, compares proteins |
NCBI Web-Based BLAST
- Go to: “Nucleotide BLAST”
-
Paste a sample sequence:
>sample_seq AGTGTCTCCCGGTCGCGCGTGGAGGTCGGTCGCTCAGAGCTGCTGGGCGCAGTTTCTCCGCCTGCTGCTT CGGCGCGGCTGTATCGGCGAGCGAGCGAGTTCCCGCGAGTTCTCGGTGGCGCTCCCCCTTCCTTTCAGTC TCCACGGACTGGCCCCTCGTCCTTCTACTTGACCGCTCCCGTCTTCCGCCGCCTTCTGGCGCTTTCCGTT GGGCCGATTCCCGCCCGCTTCCTCCTGCTTCCCATCGAAGCTCTAGAAATGAATGTTTCCATCTCTTCAG AGATGAACCAGGTAATACGCGCTGGTTCTACGAACGACAGATGAGGGAGACGGCGCGGCTAGAATCCGAG AAGAAGGGATGGCGCCGGCGGATGGGAAGAGGGTGGGAGGCGCGGAAGCGGTGTCCTCATCAGGGGAGGC AGCCCCAAGCGGCCGCCGCCGCCCTCTGGGACGTGAAGCCCGCGCCGCGCTGGGCCCGCGCTCCAGCGCT GCCATGGTTGCCAAGTTGCGTTGGCGGCCGAGAGCGGGCGCCGGTCGCCTCGGAGAGCGCGGAGGCTGGA GCCCCTTTGCTACACTGGCGCGGGTGAGGCAGGCTGGGAGGAACAAGAGTTTTTTGTTCGAAGGGTTTTG GGGGGCCTGGGTTAGGGCGCCGCGGGCGGGGATGACCCGCCGGAAGGAGGGCGCGGGACTCCCCGTTCTT GCTGTCAGGAACGGACGCCTCGCCTCGGGTTTGCCTGGGGTTTGGGATTCTCTTCTGGAAGAGCTCTCGA GACTCGGCTCGTGTGGGCGGGCAGCCAGCCCCGGGCCTGGAGTAGGGTGGCACGGAGTCCCCGATCGCCG TGGGCCGCGGGGTCCTTTGTTCCCGCTCCACGTTGCCCGCTTTTCTTGCCAAGCGCGGGGAGAAGGGGGC GGGAGGAGGGAGGGAGCGGCTGCCCTGACGTGTCGGTACTGAGTGACTGCGGGGCTGGCCAATCCGGGGC GGGGGTGTGCGGGTGCTGGGGGCCTCGCCTCGCAGCCTGCGGAGTGGGCGCCGGCCTGGCTGCGCGAGGA GGAAGGCCTGGGACGCTCTTTCTTTTTTATGAAAGAAATCAGTGGCAAGATTTGCTCTTTTTCCGTCCCT CCACGCTTTTGGTTAAGTGTCTCTGATTATAAGCTCTTGATGATAGGAAGGTATCAGGCTGAGGGTTGAA CCTAGGGTAACTTGAACCACTACTTGAGAACTACATTTACTTTTTCCCCCAATAGGTAGTGGACATATCT ATTGGTTTGAGACAGCTGACATTTCAAGGAGAAATCAGATGTCCAAAAGGGCGCATTTTTGTGATGGAGC GTGCAGTGATGGAGCGTTAGAACACCTTGGCATCAAGCTGTTCGTTGAGTGTGTCGTGGTCTTCTGTCTA CTAATAGATGACAACTCTGGAAGCCTAGTACCACTCTTAACAGATGAATAAGTACAGCATGGACTAGACT GCCACAGGCCATGCTTTCTTTTAATAATTCTAGCACCAGTGATTGATTTAGGAAAAACAAAATACTGATG ATTACTTTTAGGCTAAAGCCTGCTGACACTTCTGTCTTAAAGATACTGAAAGAGTAGTTGTATTTGTTAA GTCTGGACGTGAGGTAAACATGGACTTTAGAATTGAATTGAGACTAGTATCATTTAACGCCAGCTGGCAG GCTGCTTATCAAGCTTATAATTTGGTAGCCAGAGGTAAACGGAACTTGAGCCACTGACCAAAGAGAGCCC TGGAATGGTTTTCCTCTGTGTTTTCCTAATAGATGATATCTCTGGTTAACTAATAGATACTAATTTCTAT AGCCATTGTCTTAATTTGTAGTTGATTTTCTAACTTTCCCCCCAAGACAAAACATTTCAGGTTTTAGTCT TAGTTTTAAATTAGTGTCTTTTTGGCTACTTGCTTTTGGAAGGTGGGATTTTTTCTTGCTTGAAGGATTT GTTAGATGGTAATTAAATGTAGTTTTGCAAATACGTTTTTAAATATAAATGTTTTCCTGTTAAGGAAGTA TCTTAATTGATATTAAGATGAAGTAACACTAAGTAAGTCATTTCATCCACTTTTTAGCAGTGCGATTGTA - Select Database:
core_ntorNucleotide collection(or try each one separately) - Organism (Optional): Homo sapiens (if necessary)
- Select program/algorithm and Click: “BLAST”
- Output:
- Descriptions: Score, E-value, identities
- Graphical alignment
- Pairwise-matches
- Taxonomy etc.
Command-line BLAST
Requisites:
module load blast+/2.15.0
# check help
blastn -help
# We already have the NT database available on Ceres
export NT=/reference/data/NCBI/blast/2025-01-16/
blastn -query gene.fna -task blastn -db $NT/nt -num_threads 36 -out gene-nt1.blast.xml
If the database weren’t already available, we would have to make the blast database:
makeblastdb -in db.fa -dbtype nucl -out db
Then run blastn
blastn -query query.fa -db db -out results.txt -outfmt 6
Sources
- Bioinformatics Workbook [Online] Available at: https://bioinformaticsworkbook.org/#gsc.tab=0 (Accessed April 5, 2025)
- Anderson, E.C (2024). Practical Computing and Bioinformatics for Conservation and Evolutionary Genomics. Accessed April 11, 2025
Workshop Materials
Workshop materials and recordings available for USDA employees at the links below